Introduction: The Advancing Korean Drug Development Ecosystem and Global R&D Trends

In the modern pharmaceutical and biotechnology industry, the Asia-Pacific region, particularly South Korea, has firmly established itself as a core Clinical Trial hub for global innovative drug development. Analyzing the Investigational New Drug (IND) approval data by the Korea Ministry of Food and Drug Safety (MFDS) during September 2026, it is evident that a wide range of multinational Clinical Trial designs are being extensively deployed across various therapeutic areas. This includes targeted therapies centered on oncology, next-generation metabolic disease treatments including obesity, and therapies for rare neurological disorders, all driven by advanced Clinical Trials.

 

This report analyzes the pipeline strategies of global pharmaceutical companies and Contract Research Organizations (CROs) based on a total of 56 Clinical Trial approvals granted from September 1 to September 30, 2026. By deeply illuminating the mechanism of action (MoA), pharmacokinetic properties, and molecular biological approaches of each pipeline designed to overcome the limitations of existing treatments, we aim to provide comprehensive insights for establishing next-generation Clinical Trial strategies for domestic and international pharmaceutical and biotech professionals. Specifically, the mechanisms for overcoming acquired resistance in antibody-drug conjugates (ADCs) and the structural innovations in next-generation obesity treatments are the most critical observation points suggested by this Clinical Trial approval list.

 

Check the MFDS IND Approval Status (2026-09-01~2026-09-30)

 

Quantitative Data Analysis of MFDS-Approved Clinical Trials in September 2026

The total number of Clinical Trials approved by the MFDS in September 2026 was 56. Among these, overseas development (Global) Clinical Trials led by multinational pharmaceutical companies and global CROs accounted for 40 cases, representing approximately 71.4% of the total, while domestic development accounted for 16 cases (28.6%). This indicates that Korea is firmly functioning as a major participating country in global Clinical Trials, backed by its excellent medical infrastructure and the high reliability of its Clinical Trial data in verifying the efficacy and safety of new drugs.

 

Distribution by Clinical Trial Phase and Development Region

Examining the approved Clinical Trial data by phase, Phase 3 Clinical Trials, which serve as the decisive gateway for new drug approval, accounted for the highest proportion with 25 cases. This was followed by 10 Phase 2 Clinical Trials, 5 Phase 1 Clinical Trials, 5 Investigator-Initiated Clinical Trials (IIT), and 3 Phase 1/2 Clinical Trials.

 

Table 1. Distribution of Clinical Trial Approvals by Development Region and Phase

Clinical Trial Phase	Domestic Development	Global Development	Total
Phase 3	3	22	25
Phase 2	3	7	10
Phase 1	2	3	5
IIT	5	0	5
Phase 1/2	1	2	3
Extension	0	2	2
Other (1b, 2b, 3b)	2	4	6
Total	16	40	56

 

The overwhelming proportion of Phase 3 Clinical Trials (about 44.6% of the total) signifies that global blockbuster new drug candidates, whose safety and preliminary efficacy have already been verified in early clinical stages, are entering large-scale confirmatory Clinical Trials targeting domestic patients. In particular, 22 of the global development cases are concentrated in Phase 3 Clinical Trials, demonstrating that the deployment of late-stage Clinical Trial pipelines by multinational pharmaceutical companies is highly active in the Korean market.

 

Key Sponsor and CRO Trends

A notable point in this month’s Clinical Trial approval status is the dominance of global CROs. IQVIA Korea recorded the highest performance by receiving approvals for 5 Clinical Trials, followed by Fortrea Korea and ICON Clinical Research Korea, which received approvals for 4 Clinical Trials each.

 

Table 2. Companies with the Most IND Approvals for Clinical Trials (Sponsor / CRO)

Company Name	IND Approvals	Main Role
IQVIA Korea	5	Global CRO
Fortrea Korea	4	Global CRO
ICON Clinical Research	4	Global CRO
Roche Korea	3	Global Pharma
PPD	3	Global CRO
Medpace Inc.	2	Global CRO

 

Among global pharmaceutical companies, Roche Korea stood out with 3 Clinical Trial approvals, while Pfizer Korea, AstraZeneca Korea, and MSD Korea recorded 2 Clinical Trials each. This phenomenon of global CRO and multinational pharma dominance highlights the complexity of modern drug development, where massive multinational patient data management and advanced Clinical Trial operational capabilities are absolutely essential.

 

Distribution by Therapeutic Area

Classifying the pipelines by therapeutic area, the Oncology & Hematology field accounted for the largest share among single disease groups with 20 Clinical Trials. This was followed by Other/General Diseases with 12 Clinical Trials, Gastroenterology & Hepatology with 6 Clinical Trials, Metabolic & Cardiovascular with 6 Clinical Trials, and Neurology & Rare Diseases with 5 Clinical Trials. Based on this macroeconomic data, we analyze the molecular biological mechanisms and the market’s unmet needs of the core Clinical Trials approved for each disease group.

 

Oncology: Advancement of Antibody-Drug Conjugates (ADCs) and Resistance Overcoming Strategies

The oncology field has fully entered the era of ADCs, moving beyond conventional targeted therapies and immunotherapies. A significant number of the 20 oncology Clinical Trials approved this month consist of pipelines related to ADCs and bispecific antibodies. In particular, attempts to improve payloads and drug delivery mechanisms within the tumor microenvironment are highly prominent.

 

Advances in TROP2-Targeted ADCs: Sacituzumab Tirumotecan (MK-2870)

TROP2 (Trophoblast cell surface antigen 2) is a 46-kDa monomeric glycoprotein overexpressed in various solid tumors such as breast cancer, urothelial cancer, and lung cancer, firmly establishing itself as a potent ADC target. In tumor cells, TROP2 is expressed up to 2 to 10 times more than in normal cells and continuously undergoes rapid endocytosis to move to the lysosome, providing an ideal environment for intracellular drug delivery. This month, MSD Korea received approvals for two major late-stage Clinical Trials regarding ‘Sacituzumab Tirumotecan (MK-2870)’, a TROP2-targeted ADC. One is a Phase 3 Clinical Trial targeting patients with muscle-invasive bladder cancer (MIBC) opting for bladder preservation, to be used in combination with Pembrolizumab, and the other is a Phase 1/2 master platform Clinical Trial targeting patients with metastatic castration-resistant prostate cancer (mCRPC).

 

Sacituzumab Tirumotecan uses a novel DNA Topoisomerase I inhibitor, a Belotecan derivative, as its payload and applies a new linker technology designed to stably release the payload within the tumor microenvironment. Unlike earlier ADCs that used tubulin inhibitors acting mainly on dividing cells, the Topoisomerase I inhibitor payload possesses cell membrane permeability, effectively mediating a bystander effect that kills adjacent antigen-negative tumor cells. According to early Clinical Trial data, although Sacituzumab Tirumotecan is associated with stomatitis, nausea, and neutropenia, it displays a manageable safety profile, securing meaningful differentiation compared to other payloads known to cause severe interstitial lung disease (ILD).

 

Concurrently, Fortrea Korea received approval for a Phase 2 platform Clinical Trial (PATAGONIA) and an Osimertinib combination Phase 2 Clinical Trial (GROVE) evaluating a ‘Datopotamab deruxtecan (Dato-DXd)’-based combination therapy targeting the same TROP2 in non-small cell lung cancer (NSCLC) patients. This clearly illustrates that the fierce development competition between MSD and AstraZeneca/Daiichi Sankyo in the TROP2-targeted ADC market is being vividly reproduced in the Korean Clinical Trial field.

 

ADC Resistance Mechanisms and Next-Generation Challenges

Despite the explosive clinical success of ADCs, acquired resistance is a core challenge that must be rigorously considered when designing any Clinical Trial. The action of an ADC goes through a series of continuous processes: antigen recognition, internalization, lysosomal trafficking, and payload release. Under continuous ADC exposure, tumor cells evade ADC recognition by downregulating the expression of the target antigen or inducing antigen drift through genetic mutations. According to the ZEPHIR study, due to spatial heterogeneity within tumors, antigen-negative cell subpopulations that are difficult to eliminate through the bystander effect alone survive in about 46% of lesions, causing disease recurrence.

 

Furthermore, alterations in endocytic pathways represent a crucial resistance mechanism. According to in vitro studies of T-DM1 resistance models, resistant cells overexpress Caveolin-1, bypassing the clathrin-mediated lysosomal pathway and routing tumor surface antigens to the Caveolin-mediated pathway, thereby physically blocking the normal release of the payload. Also, the reprogramming of receptor tyrosine kinase (RTK) networks or the hyperactivation of bypass signaling systems like JAK/STAT3 and MAPK/ERK upregulates anti-apoptotic genes (such as Bcl-2), neutralizing the apoptosis signals induced by the payload.

 

The Phase 3 Clinical Trial combining Sacituzumab Tirumotecan and the immune checkpoint inhibitor Pembrolizumab, included in this approval list, is interpreted as a multifaceted strategic approach to overcome such complex intracellular resistance mechanisms through bypass signal blockade and immune system activation. Complex Clinical Trials conducted to overcome the limitations of monotherapy will become the backbone of future oncology research.

 

Metabolic & Cardiovascular: Dual-Acting Incretins and Paradigm Shifts in Obesity Treatment

In the obesity and metabolic disease sector, which is currently the hottest topic in the global healthcare industry, highly innovative Clinical Trials have been approved in large numbers. In September 2026, 6 global development Clinical Trials were approved in this specific area, focusing heavily on next-generation metabolic control pipelines.

 

Innovation in Antibody-Peptide Conjugates (APC): Maridebart Cafraglutide (AMG 133 / MariTide)

The most prominent pipeline is the Phase 3 Clinical Trial of ‘Maridebart Cafraglutide (Code name: AMG 133, Brand name: MariTide)’, developed by Amgen and managed by IQVIA Korea. This multinational Clinical Trial (MARITIME program) targeting patients with type 2 diabetes and obesity verifies the commercial viability of a next-generation obesity treatment that structurally overcomes the half-life limitations of existing first-generation GLP-1 agonists.

 

Existing peptide-based obesity treatments have a short half-life, making once-daily or once-weekly administration inevitable. In contrast, Maridebart Cafraglutide has a unique bispecific molecular structure called an ‘Antibody-Peptide Conjugate (APC)’, in which two GLP-1 agonist peptides are linked via amino acid linkers to specific sites (E384C) of a fully human monoclonal GIP receptor antagonist antibody (GIPR Antagonist mAb) backbone. Thanks to the extended half-life provided by the antibody backbone (IgG Fc), the dosing interval can be increased to once a month, and during the weight maintenance phase, it can be extended to 4 to 6 times a year, drastically improving patient compliance.

 

In terms of the mechanism of action, Maridebart Cafraglutide takes a paradoxical approach by simultaneously activating the GLP-1 receptor (Agonism) to suppress appetite and delay gastric emptying, while inhibiting the GIP receptor (Antagonism). This is the exact opposite mechanism of Tirzepatide, which activates the GIP receptor. According to preclinical monkey models and human genetic analyses, GIP receptor inhibition reduces fat storage and improves energy metabolism, creating a powerful synergistic effect with GLP-1 activation.

 

According to Phase 2 Clinical Trial data recently published in the New England Journal of Medicine (NEJM), this drug demonstrated up to 20% weight loss compared to placebo at week 52 (17% in those with concurrent type 2 diabetes) and showed a continuous weight loss trend without a weight loss plateau. In particular, body composition analysis showed that it suppressed lean mass loss to 9-12% while significantly reducing fat mass by up to 37%, and improved overall metabolic indicators, such as lowering HbA1c by up to 2.2 percentage points. Although gastrointestinal adverse events such as nausea and vomiting, similar to existing incretin therapies, were reported, the Clinical Trial cohort applying a dose escalation protocol successfully controlled the discontinuation rate due to GI side effects to just 8%. The Phase 3 Clinical Trial initiated based on these solid scientific achievements is highly expected to present a new clinical standard for the treatment of metabolic diseases in obesity.

 

Neurology & Rare Diseases: Precision Targeting of Pathophysiology in Intractable Diseases

In the field of neurology and rare diseases, Clinical Trials of small molecule compounds and nucleic acid therapeutics that precisely modulate pathophysiological mechanisms to minimize side effects and maximize efficacy are notable. The 5 multinational Clinical Trials approved in this field share the ultimate goal of fundamentally improving patients’ quality of life (QoL).

 

A New Breakthrough in Epilepsy Treatment: OV329 (GABA-AT Inhibitor)

The Phase 2 Clinical Trial of Ovid Therapeutics’ ‘OV329’, managed by Syneos Health Korea, evaluates the potential anti-seizure activity and safety as an adjunctive therapy in adult patients with drug-resistant focal epilepsy. In epilepsy treatment, artificially maintaining high levels of GABA (Gamma-aminobutyric acid), the primary inhibitory neurotransmitter in the brain, is a core principle for suppressing neuronal hyperexcitability and preventing seizures.

 

OV329 is a next-generation inhibitor that suppresses GABA-aminotransferase (GABA-AT), the enzyme responsible for degrading GABA. Existing first-generation GABA-AT inhibitors, like vigabatrin, had excellent seizure suppression effects but carried the fatal limitation of accumulating irreversibly in the retina, causing severe ophthalmic toxicity such as visual field defects. In contrast, OV329 possesses an outstanding pharmacokinetic profile characterized by a short half-life and quick tissue elimination immediately after exerting extremely rapid and potent enzyme inhibition, thereby fundamentally blocking the risk of ocular accumulation.

 

According to animal models and Phase 1 Clinical Trial results, it demonstrated much stronger enzyme inhibition capacity (53% inhibition at 5mg dosing based on APB muscle) than vigabatrin (about 35% inhibition) at therapeutic doses without retinal toxicity, maximizing central nervous system inhibitory activity. Furthermore, since no signs of tolerance or addiction liability have been observed, broad scalability as an analgesic for pain management is also anticipated. For patients with intractable epilepsy, the entry of OV329 into a Phase 2 Clinical Trial, having resolved the burden of ophthalmic side effects, will present a groundbreaking clinical alternative.

 

Precision Gene Targeting for Duchenne Muscular Dystrophy (DMD): Brogidirsen (NS-089/NCNP-02)

The Phase 2 extension Clinical Trial of ‘Brogidirsen (Code name: NS-089/NCNP-02)’ conducted by Medpace is also generating immense expectations in the pediatric rare disease area. Duchenne Muscular Dystrophy (DMD) is an X-linked rare disease that causes progressive skeletal muscle degeneration and respiratory/cardiac muscle damage due to mutations in the dystrophin gene, leading to fatal complications in the late teens.

 

Brogidirsen, co-developed by the National Center of Neurology and Psychiatry (NCNP) of Japan and Nippon Shinyaku, is an antisense oligonucleotide (ASO) based on an unmodified Phosphorodiamidate Morpholino Oligomer (PMO) designed to induce skipping of exon 44 in the dystrophin gene. Unlike conventional ASO therapies that carry a charge and suffer from tissue toxicity and stability issues, Brogidirsen’s PMO structure is uncharged, providing excellent in vivo stability and a superior safety profile.

 

Molecularly, this drug consists of 24 base sequences (‘TTGTGTCTTTCTTCTGTTAGCCAC’) and applies a novel ‘dual-targeting’ technology that simultaneously strikes positions 64-75 and 92-103 within exon 44. This causes the mutated exon to be skipped during the RNA splicing process, inducing the production of a truncated but structurally and functionally maintained dystrophin protein. In cell-based experiments, it showed excellent skipping efficiency with an EC50 value of 0.63 μmol/L.

 

According to the recently published 5-year long-term follow-up data of the Phase 1/2 extension Clinical Trial, high exon skipping efficiency and dystrophin expression were consistently maintained in a group of 6 patients who received weekly intravenous (IV) administration, and not a single severe adverse event, such as anaphylaxis,